This site uses cookies. Some of these cookies are essential to the operation of the site, while others help to improve your experience by providing insights into how the site is being used. For more information, please see the ProZ.com privacy policy.
Cookie settings
  1. KudoZ™ Top
  2. English to French
  3. Genetics

linker-tailed DNA

French translation: ADN se terminant par une séquence de liaison

22:54 Sep 29, 2006
English to French translations [PRO]
Science - Genetics / Genetic engeneering
English term or phrase: linker-tailed DNA
Là aussi, j'ai du mal à trouver une traduction correcte et concise.

Plasmid pIC19R was digested to completion with restriction enzyme SacI, the enzyme was inactivated by heat treatment, and the plasmid DNA was ligated on ice overnight with an 80-fold excess of nonphosphorylated oligonucleotide linker having the sequence 5' GAGTTCAGGCTTTTTCATAGCT 3', where AGCT is complementary to the overhanging ends generated by SacI digestion. The *linker-tailed DNA* was then cut to completion with enzyme HindIII, the enzyme was inactivated, and the DNA precipitated with ethanol.

Je pense comprendre ce dont il s'agit, à savoir de l'ADN (plasmidique) doté d'une (ou de deux ???) extension(s?) par une séquence de liaison. Est-ce bien cela et existe-t-il une expression consacrée en français ?

Merci !
Jean-Marc (X)
France
Local time: 09:29
French translation:ADN se terminant par une séquence de liaison
Explanation:
au moins du côté où on lâche le zenzyme sauvage
un petit glossaire ici
http://www.pasteur.fr/recherche/DicoAF.html
Selected response from:

Hervé du Verle
Local time: 03:29
Grading comment
Merci Hervé. Dommage là aussi.
2 KudoZ points were awarded for this answer



Summary of answers provided
4 +1ADN se terminant par une séquence de liaison
Hervé du Verle


  

Answers


19 mins   confidence: Answerer confidence 4/5Answerer confidence 4/5 peer agreement (net): +1
linker-tailed dna
ADN se terminant par une séquence de liaison


Explanation:
au moins du côté où on lâche le zenzyme sauvage
un petit glossaire ici
http://www.pasteur.fr/recherche/DicoAF.html


Hervé du Verle
Local time: 03:29
Specializes in field
Native speaker of: Native in FrenchFrench
PRO pts in category: 15
Grading comment
Merci Hervé. Dommage là aussi.

Peer comments on this answer (and responses from the answerer)
agree  januschpoter
3 days 15 hrs
Login to enter a peer comment (or grade)



Login or register (free and only takes a few minutes) to participate in this question.

You will also have access to many other tools and opportunities designed for those who have language-related jobs (or are passionate about them). Participation is free and the site has a strict confidentiality policy.

Return to KudoZ list

KudoZ™ translation help

The KudoZ network provides a framework for translators and others to assist each other with translations or explanations of terms and short phrases.

See also:
ProZ.com term search
Search millions of term translations
Close search
Term search
  • All of ProZ.com
  • Term search
  • Jobs
  • Forums
  • Multiple search